Quest 9: Encoded in the Scales
- Keep top level comments as only solutions, if you want to say something other than a solution put it in a new post. (replies to comments can be whatever)
- You can send code in code blocks by using three backticks, the code, and then three backticks or use something such as https://topaz.github.io/paste/ if you prefer sending it through a URL
Link to participate: https://everybody.codes/
Haskell
Not particularly optimized but good enough.
import Control.Arrow ((***)) import Data.Array (assocs) import Data.Function (on) import Data.Graph import Data.List import Data.Map (Map) import Data.Map qualified as Map import Data.Maybe readInput :: String -> Map Int [Char] readInput = Map.fromList . map ((read *** tail) . break (== ':')) . lines findRelations :: Map Int [Char] -> Graph findRelations dna = buildG (1, Map.size dna) . concatMap (\(x, (y, z)) -> [(x, y), (x, z)]) . mapMaybe (\x -> (x,) <$> findParents x) $ Map.keys dna where findParents x = find (isChild x) $ [(y, z) | (y : zs) <- tails $ delete x $ Map.keys dna, z <- zs] isChild x (y, z) = all (\(a, b, c) -> a == b || a == c) $ zip3 (dna Map.! x) (dna Map.! y) (dna Map.! z) scores :: Map Int [Char] -> Graph -> [Int] scores dna relations = [similarity x y * similarity x z | (x, [y, z]) <- assocs relations] where similarity i j = length . filter (uncurry (==)) $ zip (dna Map.! i) (dna Map.! j) part1, part2, part3 :: Map Int [Char] -> Int part1 = sum . (scores <*> findRelations) part2 = part1 part3 = sum . maximumBy (compare `on` length) . components . findRelations main = do readFile "everybody_codes_e2025_q09_p1.txt" >>= print . part1 . readInput readFile "everybody_codes_e2025_q09_p2.txt" >>= print . part2 . readInput readFile "everybody_codes_e2025_q09_p3.txt" >>= print . part3 . readInputNim
Very messy bruteforce.
I’ve had some problems with parsing in part 2 - I didn’t account for double digit numbers before dna sequences and that caused my code to work on example, but silently fail only on the real input. I’ve figured it out after ~30 minutes with some external help.
Part 3 runs in 700ms - not great, but not too bad either.
proc similarity(a, b: string): int = for i, c in a: if c == b[i]: inc result proc solve_part1*(input: string): Solution = var sim: seq[int] var dnaList: seq[string] for line in input.splitLines(): dnaList.add line[2..^1] for i in 0 .. dnaList.high: for j in i+1 .. dnaList.high: let s = similarity(dnaList[i], dnaList[j]) sim.add s sim.sort() result := sim[^2] * sim[^1] proc parentTest(ch, p1, p2: string): bool = for i, c in ch: if (c != p1[i]) and (c != p2[i]): return false true proc simTable(dnaList: seq[string]): seq[seq[int]] = result = newSeqWith(dnaList.len, newseq[int](dnaList.len)) for i in 0 .. dnaList.high: for j in i+1 .. dnaList.high: let s = similarity(dnaList[i], dnaList[j]) result[i][j] = s result[j][i] = s proc solve_part2*(input: string): Solution = var dnaList: seq[string] for line in input.splitLines(): dnaList.add line.split(':')[1] let sim = simTable(dnaList) var indices = toseq(0..dnaList.high) for i, childDna in dnaList: var indices = indices indices.del i block doTest: for k in 0 .. indices.high: for j in k+1 .. indices.high: let p1 = indices[k] let p2 = indices[j] if parentTest(childDna, dnaList[p1], dnaList[p2]): result.intVal += sim[i][p1] * sim[i][p2] break doTest proc solve_part3*(input: string): Solution = var dnaList: seq[string] for line in input.splitLines(): dnaList.add line.split(':')[1] var families: seq[set[int16]] var indices = toseq(0..dnaList.high) for ch, childDna in dnaList: var indices = indices indices.del ch block doTest: for k in 0 .. indices.high: for j in k+1 .. indices.high: let p1 = indices[k] let p2 = indices[j] if parentTest(childDna, dnaList[p1], dnaList[p2]): families.add {ch.int16, p1.int16, p2.int16} break doTest var combined: seq[set[int16]] while families.len > 0: combined.add families.pop() var i = 0 while i <= families.high: if (combined[^1] * families[i]).len > 0: combined[^1] = combined[^1] + families[i] families.del i i = 0 else: inc i let maxInd = combined.mapIt(it.len).maxIndex result := combined[maxInd].toseq.mapIt(it.int+1).sum()Full solution at Codeberg: solution.nim
I’m sure there are 17 different graph libraries I could have used for the graph representation and connected components, but it seemed to be in the spirit of the question to write it myself. Nothing interesting about the parent search though – it’s just brute-force comparison.
(ql:quickload :str) (defun parse-line (line) (let ((index-and-codes (str:split ":" line))) (cons (parse-integer (car index-and-codes)) (cadr index-and-codes)))) (defun read-inputs (filename) (let ((input-lines (uiop:read-file-lines filename))) (mapcar #'parse-line input-lines))) (defun can-be-child-of? (parent1 parent2 child) (loop for i from 0 to (1- (length child)) unless (or (eql (char child i) (char parent1 i)) (eql (char child i) (char parent2 i))) return nil finally (return t))) (defun similarity (genome1 genome2) (loop for i from 0 to (1- (length genome1)) sum (if (eql (char genome1 i) (char genome2 i)) 1 0))) (defun main-1 (filename) (let ((genomes (read-inputs filename))) (loop for arrangement in '((1 2 3) (2 3 1) (3 1 2)) maximize (destructuring-bind (parent1-index parent2-index child-index) arrangement (let ((parent1 (cdr (assoc parent1-index genomes))) (parent2 (cdr (assoc parent2-index genomes))) (child (cdr (assoc child-index genomes)))) (if (can-be-child-of? parent1 parent2 child) (* (similarity parent1 child) (similarity parent2 child)) 0)))))) (defun find-parents (genomes child-pair) (loop named loop1 for tail1 on genomes for parent1-pair = (car tail1) do (loop for parent2-pair in (cdr tail1) when (and (/= (car parent1-pair) (car child-pair)) (/= (car parent2-pair) (car child-pair)) (can-be-child-of? (cdr parent1-pair) (cdr parent2-pair) (cdr child-pair))) do (return-from loop1 (cons (car parent1-pair) (car parent2-pair)))) finally (return-from loop1 nil))) (defun child-relationships (genomes) (mapcar #'(lambda (child-pair) (cons (car child-pair) (find-parents genomes child-pair))) genomes)) (defun main-2 (filename) (let* ((genomes (read-inputs filename)) (child-relationships (child-relationships genomes))) (loop for child-rel in child-relationships sum (destructuring-bind (child-idx . parent-idxs) child-rel (if (null parent-idxs) 0 (let ((parent1 (cdr (assoc (car parent-idxs) genomes))) (parent2 (cdr (assoc (cdr parent-idxs) genomes))) (child (cdr (assoc child-idx genomes)))) (* (similarity parent1 child) (similarity parent2 child)))))))) (defun relationship-graph (child-relationships) (let ((edges (mapcan #'(lambda (child-rel) (destructuring-bind (child-idx . parent-idxs) child-rel (if (null parent-idxs) nil (list (cons child-idx (car parent-idxs)) (cons child-idx (cdr parent-idxs)))))) child-relationships)) (graph (make-hash-table))) (loop for edge in edges do (destructuring-bind (x . y) edge (setf (gethash x graph) (cons y (gethash x graph))) (setf (gethash y graph) (cons x (gethash y graph))))) graph)) (defun component-of (graph vertex) (labels ((iter (so-far) (let ((next (reduce #'union (mapcar #'(lambda (v) (gethash v graph)) so-far) :initial-value so-far))) (if (subsetp next so-far) next (iter next))))) (iter (list vertex)))) (defun all-components (graph vertices) (labels ((iter (so-far vertices-left) (if (null vertices-left) so-far (let ((comp (component-of graph (car vertices-left)))) (iter (cons comp so-far) (set-difference vertices-left comp)))))) (iter nil vertices))) (defun main-3 (filename) (let* ((genomes (read-inputs filename)) (child-relationships (child-relationships genomes)) (relationship-graph (relationship-graph child-relationships)) (keys (mapcar #'car child-relationships)) (components (all-components relationship-graph keys))) (reduce #'+ (car (sort components #'(lambda (c1 c2) (> (length c1) (length c2))))))))I don’t think there’s such a thing as a “spirit of the question”, but you’re free to set your own challenges of course :)
Scheme/Guile
I was stuck on part 3 for a while, for not taking account that a child scale that I’m evaluating may already be a parent scale in some group.
(import (rnrs io ports (6)) (srfi srfi-1)) #!curly-infix (define (parse-file file-name) (let* ((lines (string-split (string-trim-both (call-with-input-file file-name get-string-all)) #\newline)) (split-lines (map (lambda (l) (string-split l #\:)) lines)) (parsed-lines (map (lambda (l) (cons (string->number (car l)) (string->list (cadr l)))) split-lines))) parsed-lines)) (define (child-score child p1 p2 p1-sim p2-sim) (if (and-map null? (list child p1 p2)) (* p1-sim p2-sim) (let ((matches-p1 (eq? (car child) (car p1))) (matches-p2 (eq? (car child) (car p2)))) (cond ((not (or matches-p1 matches-p2)) #f) (else (child-score (cdr child) (cdr p1) (cdr p2) (+ p1-sim (if matches-p1 1 0)) (+ p2-sim (if matches-p2 1 0)))))))) (let ((dna-lines (parse-file "notes/everybody_codes_e2025_q09_p1.txt"))) (format #t "P1 Answer: ~a\n\n" (or (child-score (cdar dna-lines) (cdadr dna-lines) (cdaddr dna-lines) 0 0) (child-score (cdadr dna-lines) (cdar dna-lines) (cdaddr dna-lines) 0 0) (child-score (cdaddr dna-lines) (cdadr dna-lines) (cdar dna-lines) 0 0)))) (let ((dna-lines (list->vector (parse-file "notes/everybody_codes_e2025_q09_p2.txt")))) (let loop ((child 0) (total-sim 0)) (if {child < (vector-length dna-lines)} (loop (1+ child) (+ total-sim (let loop ((i 0)) (cond ((eq? i child) (loop (1+ i))) ({i >= {(vector-length dna-lines) - 1}} 0) (else (or (let loop ((j (1+ i))) (cond ((eq? j child) (loop (1+ j))) ({j >= (vector-length dna-lines)} #f) (else (let ((res (child-score (cdr (vector-ref dna-lines child)) (cdr (vector-ref dna-lines i)) (cdr (vector-ref dna-lines j)) 0 0))) (or res (loop (1+ j))))))) (loop (1+ i)))))))) (format #t "P2 Answer: ~a\n\n" total-sim)))) (define (init-id-to-group dna-lines) (let ((table (make-hash-table))) (let loop ((i 0)) (if {i < (vector-length dna-lines)} (let ((id (car (vector-ref dna-lines i)))) (hash-set! table id id) (loop (1+ i))) table)))) (define (init-group-to-ids dna-lines) (let ((table (make-hash-table))) (let loop ((i 0)) (if {i < (vector-length dna-lines)} (let ((id (car (vector-ref dna-lines i)))) (hash-set! table id (list id)) (loop (1+ i))) table)))) (let ((dna-lines (list->vector (parse-file "notes/everybody_codes_e2025_q09_p3.txt")))) (let ((id-to-group (init-id-to-group dna-lines)) (group-to-ids (init-group-to-ids dna-lines))) (let child-loop ((child 0)) (if {child < (vector-length dna-lines)} (let i-loop ((i 0)) (cond ((eq? i child) (i-loop (1+ i))) ({i >= {(vector-length dna-lines) - 1}} (child-loop (1+ child))) (else (let j-loop ((j (1+ i))) (cond ((eq? j child) (j-loop (1+ j))) ({j >= (vector-length dna-lines)} (i-loop (1+ i))) (else (let* ((cl (vector-ref dna-lines child)) (pil (vector-ref dna-lines i)) (pjl (vector-ref dna-lines j)) (res (child-score (cdr cl) (cdr pil) (cdr pjl) 0 0))) (if res (let* ((i-group (hash-ref id-to-group (car pil))) (j-group (hash-ref id-to-group (car pjl))) (child-group (hash-ref id-to-group (car cl))) (i-group-ids (hash-ref group-to-ids i-group)) (j-group-ids (hash-ref group-to-ids j-group)) (child-group-ids (hash-ref group-to-ids child-group)) (new-group-ids (delete-duplicates (append child-group-ids (or i-group-ids '()) (or j-group-ids '()))))) (map (lambda (id) (hash-set! id-to-group id child-group)) new-group-ids) (hash-remove! group-to-ids i-group) (hash-remove! group-to-ids j-group) (hash-set! group-to-ids child-group new-group-ids) (child-loop (1+ child))) (j-loop (1+ j)))))))))) (format #t "P3 Answer: ~a\n\n" (cdr (hash-fold (lambda (_ id-list prior) (let ((group-size (length id-list)) (group-sum (apply + id-list))) (if {group-size > (car prior)} (cons group-size group-sum) prior))) (cons 0 0) group-to-ids)))))))Python
# returns parents of child if found, else None def get_parents(dnas: list[list[str]], child: int): candidates = len(dnas) seq_len = len(dnas[0]) for p1 in range(candidates): if p1 == child: continue for p2 in range(p1 + 1, candidates): if p2 == child: continue for idx in range(seq_len): if dnas[child][idx] not in [dnas[p1][idx], dnas[p2][idx]]: # mismatch found break else: # no-break => all matched return p1, p2 return None # yields all children with their parents from a collection of dnas def yield_children(dnas: list[list[str]]): for child in range(len(dnas)): parents = get_parents(dnas, child) if parents is not None: yield child, parents def part1(data: str): # parse input data into list of DNA sequences dnas = [list(dna.split(":")[1]) for dna in data.splitlines()] seq_len = len(dnas[0]) child, parents = next(yield_children(dnas)) similarities = [0, 0] for idx in range(seq_len): for pi in range(2): if dnas[child][idx] == dnas[parents[pi]][idx]: similarities[pi] += 1 return similarities[0] * similarities[1] assert ( part1("""1:CAAGCGCTAAGTTCGCTGGATGTGTGCCCGCG 2:CTTGAATTGGGCCGTTTACCTGGTTTAACCAT 3:CTAGCGCTGAGCTGGCTGCCTGGTTGACCGCG""") == 414 ) def part2(data: str): # parse input data into list of DNA sequences dnas = [list(dna.split(":")[1]) for dna in data.splitlines()] seq_len = len(dnas[0]) children_gen = yield_children(dnas) all_similarity = 0 for child, parents in children_gen: similarities = [0, 0] for idx in range(seq_len): for pi in range(2): if dnas[child][idx] == dnas[parents[pi]][idx]: similarities[pi] += 1 all_similarity += similarities[0] * similarities[1] return all_similarity assert ( part2("""1:GCAGGCGAGTATGATACCCGGCTAGCCACCCC 2:TCTCGCGAGGATATTACTGGGCCAGACCCCCC 3:GGTGGAACATTCGAAAGTTGCATAGGGTGGTG 4:GCTCGCGAGTATATTACCGAACCAGCCCCTCA 5:GCAGCTTAGTATGACCGCCAAATCGCGACTCA 6:AGTGGAACCTTGGATAGTCTCATATAGCGGCA 7:GGCGTAATAATCGGATGCTGCAGAGGCTGCTG""") == 1245 ) # Disjoint Set Union (Union-Find) data structure # with path compression and union by rank class DSU: def __init__(self, size): self.parent = list(range(size)) self.rank = [1] * size def find(self, x): # path compression if self.parent[x] != x: self.parent[x] = self.find(self.parent[x]) return self.parent[x] def union(self, x, y): rootX = self.find(x) rootY = self.find(y) if rootX == rootY: return False # union by rank # attach smaller rank tree under root of higher rank tree if self.rank[rootX] < self.rank[rootY]: self.parent[rootX] = rootY elif self.rank[rootX] > self.rank[rootY]: self.parent[rootY] = rootX else: # ranks are same, so make one as root and increment its rank by one self.parent[rootY] = rootX self.rank[rootX] += 1 return True def part3(data: str): # parse input data into list of DNA sequences dnas = [list(dna.split(":")[1]) for dna in data.splitlines()] candidates = len(dnas) dsu = DSU(candidates) children_gen = yield_children(dnas) # union children with their parents for child, (p1, p2) in children_gen: dsu.union(child, p1) dsu.union(child, p2) # record [size, scale_sum] for each group groups = {} for scale_idx in range(candidates): # find the group of the current candidate group = dsu.find(scale_idx) # update group's size and scale sum entry = groups.setdefault(group, [0, 0]) entry[0] += 1 entry[1] += scale_idx + 1 # return the maximum scale sum among all groups return max(groups.values())[1] assert ( part3("""1:GCAGGCGAGTATGATACCCGGCTAGCCACCCC 2:TCTCGCGAGGATATTACTGGGCCAGACCCCCC 3:GGTGGAACATTCGAAAGTTGCATAGGGTGGTG 4:GCTCGCGAGTATATTACCGAACCAGCCCCTCA 5:GCAGCTTAGTATGACCGCCAAATCGCGACTCA 6:AGTGGAACCTTGGATAGTCTCATATAGCGGCA 7:GGCGTAATAATCGGATGCTGCAGAGGCTGCTG""") ) == 12 assert ( part3("""1:GCAGGCGAGTATGATACCCGGCTAGCCACCCC 2:TCTCGCGAGGATATTACTGGGCCAGACCCCCC 3:GGTGGAACATTCGAAAGTTGCATAGGGTGGTG 4:GCTCGCGAGTATATTACCGAACCAGCCCCTCA 5:GCAGCTTAGTATGACCGCCAAATCGCGACTCA 6:AGTGGAACCTTGGATAGTCTCATATAGCGGCA 7:GGCGTAATAATCGGATGCTGCAGAGGCTGCTG 8:GGCGTAAAGTATGGATGCTGGCTAGGCACCCG""") ) == 36union find: nice! I was too lazy to use union find, so I brute forced merging of the families, it was fast enough :)
Yeah I’ve got the DSU algorithm ingrained because of the number of the times I had to practice it for coding rounds. I didn’t need to do path compression and union by rank either but might as well.
Wow, your interviews were tough. I was never asked anything even remotely this difficult.
Rust
use std::collections::HashMap; use bit_set::BitSet; use itertools::{Itertools, izip}; type BitSetBase = u32; fn is_child(child: &str, parent1: &str, parent2: &str) -> bool { izip!(child.chars(), parent1.chars(), parent2.chars()).all(|(c, a, b)| c == a || c == b) } fn similarity(a: &str, b: &str) -> usize { izip!(a.chars(), b.chars()).filter(|(a, b)| a == b).count() } fn unequality_bitset(a: &str, b: &str) -> BitSet<BitSetBase> { izip!(a.chars(), b.chars()) .enumerate() .filter_map(|(i, (a_ch, b_ch))| if a_ch == b_ch { None } else { Some(i) }) .collect() } pub fn solve_part_1(input: &str) -> String { let dnas = input .lines() .map(|l| { let (_, dna) = l.split_once(":").unwrap(); dna }) .collect::<Vec<_>>(); let (child, parenta, parentb) = if is_child(dnas[0], dnas[1], dnas[2]) { (dnas[0], dnas[1], dnas[2]) } else if is_child(dnas[1], dnas[0], dnas[2]) { (dnas[1], dnas[0], dnas[2]) } else { (dnas[2], dnas[0], dnas[1]) }; (similarity(child, parenta) * similarity(child, parentb)).to_string() } pub fn solve_part_2(input: &str) -> String { let dnas = input .lines() .map(|l| { let (_, dna) = l.split_once(":").unwrap(); dna }) .collect::<Vec<_>>(); let unequalities = dnas .iter() .enumerate() .cartesian_product(dnas.iter().enumerate()) .map(|((a_id, a), (b_id, b))| ((a_id, b_id), unequality_bitset(a, b))) .collect::<HashMap<_, _>>(); let mut total_similarities = 0; 'outer: for (child_id, &child_string) in dnas.iter().enumerate() { for (parent_a_id, &parent_a_string) in dnas.iter().enumerate() { if parent_a_id == child_id { continue; } for (parent_b_id, &parent_b_string) in dnas.iter().enumerate() { if parent_b_id == child_id || parent_b_id == parent_a_id { continue; } if unequalities[&(child_id, parent_a_id)] .intersection(&unequalities[&(child_id, parent_b_id)]) .count() == 0 { total_similarities += similarity(child_string, parent_a_string) * similarity(child_string, parent_b_string); continue 'outer; } } } } total_similarities.to_string() } pub fn solve_part_3(input: &str) -> String { let dnas = input .lines() .map(|l| { let (_, dna) = l.split_once(":").unwrap(); dna }) .collect::<Vec<_>>(); let unequalities = dnas .iter() .enumerate() .cartesian_product(dnas.iter().enumerate()) .map(|((a_id, a), (b_id, b))| ((a_id, b_id), unequality_bitset(a, b))) .collect::<HashMap<_, _>>(); let mut parents: HashMap<usize, (usize, usize)> = HashMap::new(); 'outer: for (child_id, _) in dnas.iter().enumerate() { for (parent_a_id, _) in dnas.iter().enumerate() { if parent_a_id == child_id { continue; } for (parent_b_id, _) in dnas.iter().enumerate() { if parent_b_id == child_id || parent_b_id == parent_a_id { continue; } if unequalities[&(child_id, parent_a_id)] .intersection(&unequalities[&(child_id, parent_b_id)]) .count() == 0 { parents.insert(child_id, (parent_a_id, parent_b_id)); continue 'outer; } } } } let mut family_id = (0usize..dnas.len()).collect::<Vec<_>>(); for (child, (parent_a, parent_b)) in parents.drain() { let destination_family_id = family_id[child]; let merge_families = (family_id[parent_a], family_id[parent_b]); for candidate_family in family_id.iter_mut() { if *candidate_family == merge_families.0 || *candidate_family == merge_families.1 { *candidate_family = destination_family_id; } } } let families = family_id .iter() .enumerate() .map(|(member_idx, &family_idx)| (family_idx, member_idx)) .into_group_map(); families .values() .max_by_key(|f| f.len()) .unwrap() .iter() .map(|member_id| member_id + 1) .sum::<usize>() .to_string() }




